Перевод thx: Thx – перевод с английского на русский – Яндекс.Переводчик

Содержание

Sir Sly — thx. — перевод песни на русский

Текст песни Sir Sly — thx.

Перевод песни Sir Sly — thx.

Скопировать текст в буфер

Скопировать перевод в буфер




Crying on the beach

Плач на пляже.

Reciting straight from three

Декламирую сразу с трех

Exciting just to be

Захватывающе просто быть

And be endlessly

И быть бесконечно . ..

Nothing’s in reach

Все в пределах досягаемости.

God described in T

Бог описан в Т

I text to say, «I’m sorry»

Я пишу, чтобы сказать: «мне очень жаль».

‘Cause I’m sorry

Потому что мне очень жаль

I’m sorry, endlessly sorry

Мне жаль, бесконечно жаль.

How could I make it up?

Как я мог это придумать?

Slate isn’t blank enough

Грифельная доска недостаточно чиста

I was trying to control

Я пытался контролировать себя.

Things out of my control

Все вышло из-под моего контроля.

Things only God can know

То, что может знать только Бог.

How’d I get this way?

Как я дошел до этого?

All these dumb mistakes

Все эти глупые ошибки

I text to say, «I’m sorry»

Я пишу, чтобы сказать: «мне очень жаль».

‘Cause I’m sorry

Потому что мне очень жаль

Yeah, I’m sorry

Да, мне очень жаль.

And thank you for loving me

И спасибо за то, что любишь меня.




Авторы: Jason Alexander Suwito, Landon Jacob Maslyn, Hayden John Coplen




Внимание! Не стесняйтесь оставлять отзывы.

Thx — Английский — Русский Переводы и примеры

Переводы пользователей

Добавлены профессиональными переводчиками и компаниями и на основе веб-страниц и открытых баз переводов.

Добавить перевод

Английский

Русский

Информация

Последнее обновление: 2010-01-20
Частота использования: 1
Качество:
Источник: Wikipedia

Последнее обновление: 2018-02-21
Частота использования: 1
Качество:
Источник: Wikipedia

Последнее обновление: 2018-02-21
Частота использования: 1
Качество:
Источник: Wikipedia

Последнее обновление: 2018-02-21
Частота использования: 1
Качество:
Источник: Wikipedia

Английский

thx.

Последнее обновление: 2018-02-21
Частота использования: 1
Качество:
Источник: Wikipedia

Английский

thx.

Русский

or is it. . .?

Последнее обновление: 2018-02-21
Частота использования: 1
Качество:
Источник: Wikipedia

Английский

thx.

Русский

sr. member

Последнее обновление: 2018-02-21
Частота использования: 1
Качество:
Источник: Wikipedia

Английский

thx.

Последнее обновление: 2018-02-21
Частота использования: 1
Качество:
Источник: Wikipedia

Английский

thx!!!

Последнее обновление: 2018-02-21
Частота использования: 1
Качество:
Источник: Wikipedia

Английский

thx 🙂

Последнее обновление: 2018-02-21
Частота использования: 1
Качество:
Источник: Wikipedia

Английский

thx!

Последнее обновление: 2018-02-21
Частота использования: 1
Качество:
Источник: Wikipedia

Английский

thx!

Последнее обновление: 2018-02-21
Частота использования: 1
Качество:
Источник: Wikipedia

Английский

thx:)

Последнее обновление: 2018-02-21
Частота использования: 1
Качество:
Источник: Wikipedia

Английский

thx:)

Русский

location: russia

Последнее обновление: 2018-02-21
Частота использования: 1
Качество:
Источник: Wikipedia

Английский

many thx

Русский

многие thx mwah :))

Последнее обновление: 2013-10-05
Частота использования: 1
Качество:
Источник: Анонимно

Английский

aww thx

Последнее обновление: 2013-02-12
Частота использования: 1
Качество:
Источник: Анонимно

Английский

thx you.

Последнее обновление: 2018-02-21
Частота использования: 1
Качество:
Источник: Анонимно

Английский

lot of thx

Последнее обновление: 2018-02-21
Частота использования: 1
Качество:
Источник: Анонимно

Английский

thx a lot

Последнее обновление: 2018-02-21
Частота использования: 1
Качество:
Источник: Анонимно

Английский

thx 2 mur.

Русский

5 4 3 2 1.. 1 2 3 4 5..5 4 3 2 1 и т.д

Последнее обновление: 2018-02-21
Частота использования: 1
Качество:
Источник: Анонимно

Получите качественный перевод благодаря усилиям


4,401,923,520 пользователей

Сейчас пользователи ищут:

Для Вашего удобства мы используем файлы cookie. Факт перехода на данный сайт подтверждает Ваше согласие на использование cookies. Подробнее. OK

No Thx — SURAN — текст песни и перевод слов, слушать онлайн бесплатно

Naega sonmok geonda haessji

Neo neo huhoehal georago

Ohae jom mallago dangdanghadeon

Geu ttae neon eodiro

Jigeum kkori usgin geo

Neodo alji

Munja ssibeun geo

Silsu anin geo alji

Na yokmeokneun geo geokjeonghaneun

Cheokhamyeonseo jebal

Kki buriji malji

Cheoeumbuteo jalharaessji

Naneun byeonhandago

Geureohge geojigati guneunde

Mam tteonassji mwo

Uriga pyeongsaengui piangsaeni

Yeokgyeoun sori jibeochigo

Ije jip jom gaja jjom

Deoreopge gulji ma majimakkkaji

Cheoleopsge sal geoni jugeul ttaekkaji

Neon nareul cheoeumbuteo

Dameul geureut anieosseo

Naega ni ane salgin

Jiral tonawa tto

Alright no thx

Alright no thx

Modeun ge da ohaeyeossda neo bireodo

Geuman no thx

Peogina mianhae

Ramyeon kkeulhireo gayadwae bye

Neon ramyeon meokgo gallae

Hal ttaega geuripgessne

But jugeossda kkaedo eopsne

No way

Hoksina bibyeobolmanhada

Saenggakhanya

Daeche eotteon yogeul

Deo wonhae wome

Deoneun uyeonin cheok

Eoljjeonggeorimyeonseo

Deoreobeuge gulji jom mareo

Oh stupid

Baekhwajeom da dulleobonikka

Namanhan mulgeoni eopsji

Geunde eojjeom johni

Jjijirihanten dasin

Pal mami eopsji

Neoneun hal mari eopsji

Ibi du gaerado

Geunyang dakchyeo

Mollasseo naega mannaneun

Donganen cheonsayeoseo

Yok hanbeon an haeseo

Sunjinhan jul algessji

Nae byeolmyeongeun sasil

Yok jidaminde merong

Alright no thx

Alright no thx

Modeun ge da ohaeyeossda neo bireodo

Geuman no thx

Peogina mianhae

Ramyeon kkeulhireo gaya dwae bye

No interview

No interview

Eotteon geosdo o o mutjimareo

Alright

Alright alright alright

Alright

I i i get it now get it now

Nal tteonani silgami na

Oh doedo anhneun maldeurina

Neureonohneun neoreul bonikka

Useumina so i

Alright no thx

Alright no thx

Modeun ge da ohaeyeossda neo bireodo

Geuman no thx

Peogina mianhae

Ramyeon kkeulhireo gaya dwae bye

Alright no thx

Alright no thx

Modeun ge da ohaeyeossda neo bireodo

Geuman no thx

Peogina mianhae

Ramyeon kkeulhireo gaya dwae bye

No interview

No interview

Eotteon geosdo mutjimareo

No interview

No interview

Singyeongkkeojwo

Love is over

Перевод песни No Thx

Была не geonda sonmok haessji

Неон неон georago huhoehal

Ohae механизм лишь dangdanghadeon

Гы ttae неон eodiro

Не kkori usgin гео

Neodo alji

Munja ssibeun гео

Silsu Анин гео alji

На yokmeokneun гео geokjeonghaneun

Cheokhamyeonseo джебал

ККИ buriji во время

Jalharaessji Cheoeumbuteo

Byeonhandago Naneun

Geojigati Geureohge guneunde

Мам tteonassji в mwo

Сайту uriga pyeongsaengui piangsaeni

Yeokgyeoun сори jibeochigo

Хочу жип ехать в этом направлении Гая jjom

Deoreopge gulji Ма majimakkkaji

Cheoleopsge соль геони ttaekkaji jugeul

Cheoeumbuteo неон nareul

Dameul geureut anieosseo

Была не ни Анэ salgin

Jiral tonawa ТТО

Ну Нет спасибо

Ну Нет спасибо

Modeun Гэ да ohaeyeossda Нео bireodo

Geuman Нет спасибо

Peogina mianhae

Ramyeon kkeulhireo gayadwae пока

Неон ramyeon meokgo gallae

Хэл ttaega geuripgessne

Но jugeossda kkaedo eopsne

Низзя

Bibyeobolmanhada Hoksina

Saenggakhanya

Daeche eotteon yogeul

Бог жизни женщи

Deoneun uyeonin чиок

Eoljjeonggeorimyeonseo

Deoreobeuge отель mareo gulji механизм

Ой тупые

Baekhwajeom дать dulleobonikka

Namanhan mulgeoni eopsji

Geunde eojjeom Джони

Jjijirihanten Дасин

Паль Мами eopsji

Neoneun Хэл море eopsji

Там дю gaerado

На dakchyeo

Mollasseo была не mannaneun

Donganen cheonsayeoseo

Hanbeon йок в haeseo

Sunjinhan июля algessji

Раскупить byeolmyeongeun sasil

Jidaminde йок меронга

Ну Нет спасибо

Ну Нет спасибо

Modeun Гэ да ohaeyeossda Нео bireodo

Geuman Нет спасибо

Peogina mianhae

Ramyeon kkeulhireo Гайя dwae пока

Никакого интервью

Никакого интервью

Eotteon geosdo о mutjimareo

Хорошо

Ну ладно, ладно

Хорошо

Я я я сделать это сейчас сделать это сейчас

Нал silgami tteonani на

Ну это doedo maldeurina

Neureonohneun мной что bonikka

Useumina так я

Ну Нет спасибо

Ну Нет спасибо

Modeun Гэ да ohaeyeossda Нео bireodo

Geuman Нет спасибо

Peogina mianhae

Ramyeon kkeulhireo Гайя dwae пока

Ну Нет спасибо

Ну Нет спасибо

Modeun Гэ да ohaeyeossda Нео bireodo

Geuman Нет спасибо

Peogina mianhae

Ramyeon kkeulhireo Гайя dwae пока

Никакого интервью

Никакого интервью

Eotteon geosdo mutjimareo

Никакого интервью

Никакого интервью

Singyeongkkeojwo

Люблю его за

THX — Перевод на английский — примеры испанский

Эти примеры могут содержать нецензурные слова, основанные на вашем поиске.

Эти примеры могут содержать разговорные слова на основе вашего поиска.

También vincular en lo posible, thx .

Также ссылка, где это возможно, thx .

12.05.2009 corrección de efecto de denunciar ( thx Tak (amigo de Pablo)), изменено для juegos de mesa, Beacon agregó.

2009.12.05 Исправлен эффект Bury ( thx Tak (друг Пола)), изменены наборы столов, добавлен Beacon.

Пожалуйста, добавьте меня в избранное в список поставщиков, thx ! La comunicación puede resolver 100% de problemas, nos preocupamos de cada clienteindividual.

Пожалуйста, добавьте меня в список любимых продавцов, , спасибо ! Общение может решить 100% проблем, мы заботимся о каждом клиенте.

Por lo tanto, thx por catorce días para saber de usted. Милан

Итак, thx в течение четырнадцати дней, чтобы услышать от вас. Милан

Укажите ми servidor y tenga a algunos siempre buscando personal nuevo, porfavor solicite thx

Присоединяйтесь к моему серверу, и некоторые всегда ищут новых сотрудников, поэтому, пожалуйста, подайте заявку thx 😉

Arreglado: en los unís con la url foxgame no funcionaba debido a un error de deletreo ( thx Don Gilardino).

Исправлено: юнис не работал из-за опечатки ( thx Don Gilardino)

Приведен ретроградный индекс для THX 11384EB.

Отправьте ретроградный индекс на THX 1 1 38 4EB.

Контактное лицо наблюдения THX 11384EB.

Наблюдательный контакт с THX 1 1 38 4EB.

THX y Лазерный станок, созданный в союзе.

THX и Laser создали альянс.

Bien, entonces, retírese, THX 1138.

Хорошо, тогда просто отстань, THX 1 1 38.

Звуковая система THX , активация навигации по телефону.

Аудиосистема THX , голосовая навигация.

THX es más bien un sistema de control de calidad.

THX в основном представляет собой систему обеспечения качества.

Pronto se descubre Que THX está escapando de su comunidad.

Вскоре выясняется, что THX сбегает из своего сообщества.

Inicien el desafío de la ciudadela, версия THX , переменная 1138.

Запустите вызов цитадели, версия , спасибо , переменная 1138.

Sirvió como base para su primer largometraje, THX 1138.

Это должен был быть его последний короткометражный фильм перед его первым полнометражным фильмом, THX 1138.

В 2002 г., THX , компания Creative Technology Limited с долей участия 60 % компании.

В 2002 году THX принадлежала производителю звуковых карт Creative Technology Limited, которому принадлежало 60% акций компании.

Necesitamos un perfil de tratamiento para THX 11383EB.

Нам нужен профиль лечения на THX 1 1 38 3EB.

THX 1138 нет tiene un registro previo de desviación.

THX 1 1 38 не имеет предыдущей записи об отклонении.

Sujeto THX 11384EB не отвечает по заказу.

Субъект THX 1 1 38 4EB не отвечает на команду.

Разрешение на авторизацию для умственного блока по номеру THX 11384EB.

Теперь у нас есть разрешение на блокировку памяти THX 1 1 38 4EB.

Genius English Translations – No Thx (английский перевод) Lyrics

No Thx (английский перевод) Lyrics

Я сказал, что ставлю на это
Вы сказали, что пожалеете об этом
Не поймите неправильно
Тогда вы были уверены, откуда ты ходишь
Прямо сейчас ты выглядишь смешно
Ты тоже это знаешь
Что я игнорирую твои сообщения
Ты знаешь, что это не ошибка
Делая вид, что волнуешься
Что меня оскорбляют
Пожалуйста, не флиртуй

Ты С самого начала сказал мне, чтобы я преуспел
Ты сказал, что я изменился
Вот так я вел себя как нищий
Мой разум только что покинул
Мы невеста на всю жизнь
Прекрати свои отвратительные звуки
Пошли домой сейчас же
Не груби, пока конец
Ты будешь жить незрелым, пока не умрешь
С самого начала ты
Не был чашей для жизни
Жизнь внутри тебя
Отвратительна

Хорошо, нет, спасибо
Хорошо, нет, спасибо
если вы извинитесь 901 32 Стоп, нет, спасибо
Мне так жаль
Мне нужно идти домой, чтобы приготовить рамен, пока

Вы должны пропустить фразу
«хотите поесть рамен?»
Но даже если бы я умер и проснулся, то никак
Ни в коем случае
Как ты думаешь
Стоит ли это смешать
Какие еще ругательства
Хочешь, ух ты
Делая вид, что это совпадение
Пока болтаюсь
Не надо я веду себя похабно
Ох глупо
Я огляделся в универмаге
И нет ничего достойного меня
Но что мне делать
У меня нет сердца
Опять продать неудачнику
Тебе нечего сказать
Даже если у тебя два рта
Просто заткнись
Ты не знал, пока мы встречались
Я был ангелом
Ни разу не ругался
Ты должно быть думал, что я наивен
Честно говоря мой никнейм
Йок* Джидам, нинер neener

Хорошо, нет, спасибо
Хорошо, нет, спасибо
Это было недоразумение, даже если ты извинишься
Ничего не спрашивай
Хорошо
Хорошо хорошо хорошо
Хорошо
Я понимаю сейчас получаю сейчас
Ты меня покидаешь? будь реалистом
О, слова, которые не имеют смысла
Я видел, как ты оправдываешься
И я смеялся, поэтому я

Хорошо, нет, спасибо
Хорошо, нет, спасибо
Это было недоразумение, даже если ты извиняешься
Стоп, нет, спасибо
Я мне очень жаль
Мне нужно идти домой, чтобы приготовить рамен, пока

Хорошо, нет, спасибо
Хорошо, нет, спасибо
Это было недоразумение, даже если ты извинишься
Стоп, нет, спасибо
Мне очень жаль
Я нужно идти домой, чтобы приготовить рамен, пока

Нет интервью
Нет интервью
Ничего не спрашивайте
Нет интервью
Нет интервью
Пожалуйста, не беспокойте меня
Любовь закончилась

Переведите спасибо на испанский с контекстуальными примерами

Человеческий вклад

От профессиональных переводчиков, предприятий, веб-страниц и свободно доступных репозиториев переводов.

Добавить перевод

Последнее обновление: 2014-08-26
Частота использования: 1
Качество:
Ссылка: Википедия

Последнее обновление: 2018-02-13
Частота использования: 1
Качество:
Ссылка: Википедия

Последнее обновление: 2018-02-13
Частота использования: 1
Качество:
Ссылка: Википедия

Последнее обновление: 06. 05.2020
Частота использования: 1
Качество:
Ссылка: Аноним

Испанский

сертификация спасибо

Последнее обновление: 2016-11-24
Частота использования: 1
Качество:
Ссылка: Аноним

Испанский

сертификация спасибо

Последнее обновление: 2016-11-24
Частота использования: 1
Качество:
Ссылка: Аноним

Испанский

сертификация спасибо

Последнее обновление: 2016-11-24
Частота использования: 1
Качество:
Ссылка: Аноним

Испанский

сертификация спасибо

Последнее обновление: 2016-11-24
Частота использования: 1
Качество:
Ссылка: Аноним

Испанский

сертификация спасибо

Последнее обновление: 2016-11-24
Частота использования: 1
Качество:
Ссылка: Аноним

Испанский

сертификация спасибо

Последнее обновление: 2016-11-30
Частота использования: 1
Качество:
Ссылка: Аноним

Испанский

y eso es todo. спасибо 4 ранг.

Последнее обновление: 2018-02-13
Частота использования: 1
Качество:
Ссылка: Аноним

Последнее обновление: 2018-02-13
Частота использования: 1
Качество:
Ссылка: Аноним

Последнее обновление: 2018-02-13
Частота использования: 1
Качество:
Ссылка: Аноним

Последнее обновление: 2018-02-13
Частота использования: 1
Качество:
Ссылка: Аноним

Испанский

Спасибо!

Последнее обновление: 2018-02-13
Частота использования: 1
Качество:
Ссылка: Аноним

Английский

спасибо тебе 2!!!!!!!!!!

Последнее обновление: 2018-02-13
Частота использования: 1
Качество:
Ссылка: Аноним

Английский

спасибо тебе 2!!!!!!!!!!

Испанский

хорошего дня и большой вечеринки!!!

Последнее обновление: 2018-02-13
Частота использования: 1
Качество:
Ссылка: Аноним

Последнее обновление: 2018-02-13
Частота использования: 1
Качество:
Ссылка: Аноним

Английский

@rachelpricett, спасибо, а!

Испанский

¡@rachelpricett спасибо, а!

Последнее обновление: 24 февраля 2016 г.
Частота использования: 1
Качество:
Ссылка: Аноним

Английский

THX®-сертифицированный звук

Испанский

сертификат thx®

Последнее обновление: 2017-02-14
Частота использования: 1
Качество:
Ссылка: Аноним

Получите лучший перевод с


4 401 923 520 человеческий вклад

Пользователи теперь просят о помощи:

Мы используем файлы cookie, чтобы улучшить ваш опыт. Продолжая посещать этот сайт, вы соглашаетесь на использование нами файлов cookie. Узнать больше. Ok Переводчик азбуки Морзе

| Декодер Морзе

Что такое азбука Морзе?

Код Морзе

— это схема кодирования символов, которая позволяет операторам отправлять сообщения, используя серию электрических импульсов, представленных в виде коротких или длинных импульсов, точек и тире.

Кто изобрел азбуку Морзе?

Известно, что Сэмюэл Ф. Б. Морзе изобрел азбуку Морзе.

Когда была изобретена азбука Морзе?

Код Морзе

был разработан в 1830-х годах, а затем улучшен в 1840-х годах помощником Морзе Альфредом Льюисом Вейлом.

Когда была запатентована азбука Морзе?

Сэмюэл Морс получил патент США — US1647A — на сигналы точечно-тире телеграфии 20 июня 1840 года. С другой стороны, некоторые источники утверждают, что Сэмюэл Морс получил патент, выданный османским султаном Абдулмеджидом I, на азбуку Морзе. Однако, согласно мемуарам Сайруса Хэмлина и некрологу The New York Times , опубликованному 3 апреля 1872 года, Сэмюэл Морс вместо этого получил не патент, а орден Османской империи — Орден Славы.

Какое первое сообщение было отправлено азбукой Морзе?

«Что сотворил Бог» было первым официальным сообщением, отправленным Сэмюэлем Ф.Б. Морзе 24 мая 1844 года, чтобы открыть телеграфную линию Балтимор-Вашингтон.

Для чего используется азбука Морзе?

Азбука Морзе широко использовалась в прошлом, особенно в армии. Хотя сегодня азбука Морзе имеет ограниченную область применения, она по-прежнему используется в авиации, радиолюбительской деятельности и вспомогательных технологиях (AT).

Как пользоваться азбукой Морзе

Азбуку Морзе можно использовать различными способами, например, с помощью ручки и бумаги или с помощью света и звука. Его можно использовать даже с частями тела, такими как глаза или пальцы.

Трудно ли выучить азбуку Морзе?

Несмотря на то, что в прошлом азбука Морзе была сложной кривой обучения, благодаря современным приложениям, таким как переводчик азбуки Морзе или клавиатура Gboard, в настоящее время ее легче освоить.

Как выучить азбуку Морзе

Вы можете выучить азбуку Морзе, изучая и слушая аудиозаписи Морзе, а также применяя методы запоминания слов, которые можно найти на различных веб-сайтах.Однако одним из лучших методов изучения азбуки Морзе в 2022 году является клавиатура Gboard, разработанная Google. Благодаря упражнениям «изучаем Морзе», предоставленным Google Creative Lab, вы даже можете практиковаться в Интернете бесплатно.

Как читать азбуку Морзе

Если вы недостаточно хорошо умеете читать азбуку Морзе, вы можете найти соответствующее представление каждого символа Морзе в таблице азбуки Морзе или воспользоваться переводчиком азбуки Морзе.

Как перевести азбуку Морзе

Если вы хотите перевести или расшифровать азбуку Морзе и не знаете, как ее читать, вы можете воспользоваться онлайн-переводчиком азбуки Морзе.С помощью декодера Морзе вы можете легко декодировать азбуку Морзе и читать текст на английском языке.

Что такое переводчик азбуки Морзе?

Переводчик азбуки Морзе — это переводчик, который позволяет любому переводить текст в азбуку Морзе и легко декодировать азбуку Морзе в текст. С онлайн-переводчиком азбуки Морзе любой может преобразовать любой обычный текст на английском или другом языке в азбуку Морзе и наоборот.

Как пользоваться переводчиком азбуки Морзе

Просто введите азбуку Морзе или текст в соответствующие поля ввода, чтобы использовать конвертер азбуки Морзе.Например, вы помните тон Nokia SMS? Попробуйте расшифровать «… — …», а затем воспроизвести его звук. Как насчет расшифровки секретного сообщения на языке Морзе или текста пасхального яйца, который вы нашли в игре, в которую вы играли? Что ж, Переводчик азбуки Морзе может помочь вам, если у вас есть подключение к Интернету и желание выучить азбуку Морзе.

Что означает сигнал SOS?

SOS — это сигнал бедствия на азбуке Морзе, который во всем мире считается призывом о помощи. Впервые он был принят правительством Германии в 1905 году.Хотя некоторые люди думают, что SOS означает «Спасите наши души» или «Спасите наш корабль», его буквы ничего не означают.

Что такое SOS на азбуке Морзе?

SOS на азбуке Морзе: «… —…»

Что такое азбука Морзе для я тебя люблю?

«Я люблю тебя» на азбуке Морзе это «../.-.. — …- ./-.— — ..-»

Как поздороваться на азбуке Морзе?

«Здравствуйте» на азбуке Морзе «…. ..-.. .-.. —»

Как сказать «помощь» на азбуке Морзе?

«Справка» на азбуке Морзе — «…. . .-.. .—.», но вы также можете использовать сигнал SOS, то есть «… — …».

Что означает — азбукой Морзе?

«—» означает «О» в азбуке Морзе.

Что означают 3 точки в азбуке Морзе?

Буква S — это три точки азбуки Морзе: «…»

Может ли Siri перевести азбуку Морзе?

Да, Siri может переводить азбуку Морзе. Если вы хотите попробовать, скажите: «Привет, Siri, что такое азбука Морзе для приветствия?»

Переключение на рибосоме: рибопереключателям нужны рбелки в качестве модуляторов для регуляции трансляции для того, чтобы поддерживать 3′- и 5′-конец гомогенности:

GAATTC (EcoRI) — TAATACGACTCACTATA G (Т7 Pol) — GGTATGAAGC CTGATGAGTCCGTGAGGACG AAAGACCGTCTTCGGACGGTCTC (Хаммерхэд рибозим) — GCTTCATATAATCCTAATGATATGGTTT GGGA GTTTCTACCAAGAGCCTTAAACTCTTGATTATGAAGTCTGTCGCTTTATC CGAAATTTTATAAAGAGAAGACTCATGAATTACTTTGACCTGCCG (127 нуклеотидов ASW) – GGGTCGGCATGGCATCTTCCACCTC CTCGCGGTCCGA CCTGGGCTACTTCGGTAGGCTAAGGGAGAAG (рибозим HDV) – CCC (GGGGGAGAAG ).

Препарат Riboswitch

13 C– 15 N-меченый 127-нуклеотид add ASW был синтезирован путем транскрипции in vitro с помощью РНК-полимеразы Т7 из линеаризованной плазмидной ДНК 31 . Нуклеотиды 13 C– 15 N-меченые (rATP, rCTP, rGTP, rUTP) для транскрипции были приобретены у Silantes (Мюнхен, Германия). Конструкцию очищали препаративным электрофорезом в полиакриламидном геле в соответствии со стандартными протоколами 32 .Конструкцию помещали в воду на 5 мин при 95 °C и сразу же разбавляли в 10 раз ледяной водой. РНК была заменена буфером на буфер ЯМР (25 мМ фосфата калия, 150 мМ KCl, 5 мМ MgCl 2 , рН 7,2). Для исследований белок-РНК добавляли 5  мМ DTT.

Очистка rS1, rS1ΔD6 и rS1ΔD56

Последовательность rS1 была взята из Vibrio vulnificus (штамм CMCP6). rS1, rS1ΔD6 и rS1ΔD56 экспрессировались в клетках BL21(DE3), несущих N-концевую полигистидин- и тиоредоксин-метку.Культуры клеток выращивали на среде LB при 37°С. При OD 600 0,6–0,8 экспрессию белка индуцировали 0,5 мМ изопропил-β-D-1-тиогалактопиранозидом (IPTG) и инкубировали в течение ночи при 20 °C. Культуру собирали и ресуспендировали в 50 мМ Tris-HCl (pH 8), 300 мМ NaCl, 10 мМ имидазола, 10 мМ β-меркаптоэтанола. Белок очищали от растворимой фракции на 5-мл колонке HisTrap (GE Healthcare), используя для элюирования 50 мМ Tris-HCl (pH 8), 300 мМ NaCl, 500 мМ имидазол, 10 мМ β-меркаптоэтанол.Метки расщепляли в течение ночи и при 4 °C с использованием протеазы TEV и удаляли через вторую колонку HisTrap. Белок дополнительно очищали эксклюзионной хроматографией на колонке HiLoad 26/60 S75 (GE Healthcare) с использованием ЯМР-буфера (25 мМ фосфата калия, 150 мМ KCl, 5 мМ DTT, pH 7,2).

Очистка 30S рибосом и 30S рибосом, обедненных rS1

30S рибосомы очищали на основе His-меченых белков L7/L12 в соответствии с одностадийным протоколом Ederth et al. 33 Кратко, E.coli штамм JE28 выращивали в среде LB с добавлением 50 мкг/мл канамицина при 37°C. При ОП 600 0,6 культуру собирали центрифугированием при 4000 g в течение 5 мин. Осадок клеток ресуспендировали в буфере для лизиса (20 мМ Трис-HCl pH 7,6, 10 мМ MgCl 2 , 150 мМ KCl, 30 мМ NH 4 Cl) с добавлением 0,5 мг/мл лизоцима (50 1 мкл 00ase 2). Ед/мл) и полную таблетку с ингибитором протеазы (Roche) и дополнительно лизировали с использованием Microfluidizer M-110P (Microfluidics, США) до конечного объема 50 мл.Лизат осветляли двукратным центрифугированием при 38420 g при 4°С по 20 мин каждое. Для аффинной очистки колонку HisTrap (предварительно упакованную сефарозу Ni 2+ , 5  мл, GE Healthcare) соединяли с системой первичной хроматографии ÄKTA (GE Healthcare), предварительно уравновешенной в лизирующем буфере. После загрузки лизата колонку промывали 10 объемами колонки 7 мМ имидазола в лизирующем буфере. Очистку рибосом 30S∆S1 проводили, как описано ранее. Для элюирования рибосомного белка S1 колонку промывали 1.5 M NH 4 Cl в лизирующем буфере. Для элюирования 30S рибосом применяли уменьшающийся градиент концентрации магния от 10 мМ до 1 мМ магния. Фракции концентрировали до 1 мл с использованием центрифужных фильтрующих устройств (Vivaspin 20, MWCO 30000) и загружали в градиент сахарозы от 20% до 50% в буфере градиента сахарозы (20 мМ трис-HCl, pH 7,6, 300 мМ NH 4 ). Cl, 5 мМ Mg(OAc) 2 , 0,5 мМ ЭДТА и 7 мМ β-меркаптоэтанол). Градиенты центрифугировали в течение 16 часов при 100 000 g и 4 °C, фракционировали с помощью поршневого градиентного фракционатора (BioComp Instruments, Канада) и анализировали с помощью гель-электрофореза с SDS (дополнительная рис.8). 30S рибосомы хранили в сахарозном буфере при 4°С. Концентрацию 30S рибосом определяли по A 260 , где 1 A 260 соответствует 72 пмоль/мл 34 . Во избежание мешающего воздействия сахарозы концентрацию образца определяли в разведении 1:100 после замены буфера.

Стабильность 30S рибосом и целостность образцов ЯМР

ЯМР-эксперименты с высоким разрешением требуют, чтобы образец макромолекулярного комплекса был чистым от загрязняющих белков и нуклеиновых кислот, он должен быть монодисперсным и из-за экспериментальных ограничений метода высококонцентрированным .О чистоте конечных рибосом 30S, использованных во всех последующих экспериментах, судили с помощью анализа на основе геля по сравнению с аналогичным образом очищенными частицами 50S и 70S (дополнительная рис. 8).

Рибосомы дополнительно анализировали с помощью вестерн-блоттинга с использованием антитела 6x-His Tag (Thermo Fischer), которое позволяет селективно обнаруживать модифицированный рибосомный белок L12. Вестерн-блоттинг с этим специфическим антителом ясно показывает, что частицы 30S не содержат примесей белковых компонентов 50S.

Целостность рибосом была дополнительно проанализирована с помощью нативного композитного гель-электрофореза и количественной масс-спектрометрии (дополнительная рис.9). После проведения ЯМР-экспериментов образцы ЯМР анализировали на предмет целостности РНК и стабильности 30S рибосом. Целостность РНК проверяли с помощью денатурирующего электрофореза в полиакриламидном геле (дополнительная рис. 8). Теоретически РНК может быть расщеплена путем совместной очистки РНКаз во время подготовки рибосом. Стабильность рибосом была дополнительно проанализирована путем загрузки измеренных образцов другим градиентом сахарозы (дополнительный рисунок 10).

Анализ сдвига электрофоретической подвижности (EMSA)

EMSA для исследования связывания РНК-S1 проводили при постоянной концентрации РНК (4  мкМ) и увеличивающемся количестве белка (0–10 эквивалентов) в отсутствие и в присутствии аденина.Все образцы готовили в буфере EMSA (25 мМ фосфата калия, 75 мМ KCl, 5 мМ DTT, pH 7,2) и инкубировали в течение 30 мин на льду. Полосы разделяли на непрерывных гелях (8% PAGE) при низких мощностях (<500 мВт, 3,5 В/см) в буфере ТАМ (40 мМ Трис, 20 мМ уксусная кислота, 5 мМ MgCl 2 , рН 8,3). РНК визуализировали при окрашивании GelRed TM (Biotium) и последующем возбуждении полос при 254 нм.

Нативный композитный гель

Для анализа стабильности рибосом и анализа изменения электрофоретической подвижности были проведены нативные композитные гели, которые допускают миграцию нативных рибосом в гель 35 .Оптимизированные композитные гели состояли из 1,76% акриламида и 0,68% агарозы. Поэтому 13,5 мл 0,92% раствора агарозы охлаждали до 65 °С. Затем к раствору агарозы добавляли 3 мл предварительно нагретого буфера (0,2 М Трис, 0,125 М уксусной кислоты, 35% (вес/объем) сахарозы). Затем добавляли 1 мл акриламида (акриламид:бисакриламид 29:1), 8,5 мкл Triton-X100 и MgCl 2 (5 мМ) и нагревали до 65°C. Полимеризацию индуцировали добавлением 100 мкл APS и 20 мкл TEMED и немедленно заливали в предварительно нагретую гелевую камеру.Гель полимеризовали в течение 1 ч при 4°С. Предварительный запуск проводили при 200 В в течение 30 мин при водяном охлаждении. Рабочий буфер (40 мМ трис, 25 мМ уксусная кислота, 5 мМ MgCl 2 ) был заменен.

Рибопереключатель из 127 нуклеотидов и был получен лигированием 97-нуклеотидного фрагмента (G14–G110) с Cy5-меченой 30-нуклеотидной РНК (A111-G140) (Dharmacon), как описано ранее 36 . РНК предварительно инкубировали с 1,4 экв. аденина. Концентрация рибосом была увеличена с 1 до 10 эквивалентов при постоянной концентрации РНК, равной 1.28 мкМ. Все образцы были приготовлены в буфере ЯМР (25 мМ фосфата калия, 150 мМ KCl, 5 мМ MgCl 2 , pH 7,2) и с конечной концентрацией глицерина 10% в качестве загрузочного буфера. Образцы загружали, и гель работал в течение 1 часа и 20 минут при 200 В при водяном охлаждении. Полосы визуализировали с помощью УФ-затенения, флуоресцентного сканирования и дополнительно окрашивали Кумасси.

Экстракция рибосомной РНК

рРНК 30S рибосом анализировали с помощью электрофореза в агарозном геле. Поэтому рРНК экстрагировали 1 об.экв. PCI. Водную фазу смешивали с красителем для загрузки геля и анализировали электрофорезом в 1% агарозном геле. РНК визуализировали при окрашивании GelRed TM (Biotium).

ЯМР-спектроскопия

Все эксперименты проводились при 25 °C в ЯМР-буфере (25 мМ фосфата калия, pH 7,2, 150 мМ KCl, 5 мМ MgCl 2 ) и от 5% до 10% D 2 O Для белково-РНК, добавляли 5  мМ DTT. Для РНК, связанной с лигандом, добавляли 1,4 эквивалента 13 C- 15 N-меченого аденина. 13 C- 15 N-меченый аденин был синтезирован, как описано 37 .

Все спектры относятся к DSS (4,4-диметил-4-силапентан-1-сульфокислота). Химические сдвиги азота-15 и углерода-13 косвенно определялись отношением гиромагнитных отношений протона к 15 N (0,101329118) и 13 C (0,251449530), соответственно 38 .

Для экспериментов по титрованию 15 N-меченого 127 нуклеотида добавить чувствительный к аденину рибопереключатель с рибосомным белком S1, концентрацию РНК устанавливали на 40 мкМ.К РНК поэтапно добавляли немеченый белок rS1 в соотношении от 0 до 5.

приводят к агрегации рибосом.

ЯМР-эксперименты проводились на ЯМР-спектрометре 800 МГц, 900 МГц или 950 МГц, оснащенном криогенным зондом TCI с градиентом по оси Z 5 мм 1 H { 13 C, 15 N} TCI.Были записаны эксперименты

BEST-TROSY (спектроскопия полосового селективного возбуждения с коротким переходным процессом — оптимизированная поперечная релаксация) для наблюдения 1 H, 15 N корреляций 15 N РНК, меченной изотопом 39 . Спектры были записаны с использованием модифицированной импульсной программы 40 .

ЯМР Эксперименты анализировали с использованием программного обеспечения Bruker Biospin TopSpin 3.5. Задания выполнялись с использованием программного обеспечения Sparky 3.114 41 .

Термофорез на микроуровне

Рибопереключатель длиной 127 нуклеотидов был получен лигированием фрагмента длиной 97 нуклеотидов (G14–G110) с 30-нуклеотидной РНК, меченной Cy5 (A111–G140) (Dharmacon), как описано ранее 36 .Рибосомы 30S∆S1 метили с помощью набора Monolith NT Protein Labeling kit красно-малеимид согласно протоколу (NanoTemper Technologies). Меченый Cy5 127-нуклеотидный рибопереключатель (30 нМ) инкубировали с серией разведений 1: 1 рибосом 30S (36 мкМ) и рибосом 30SΔS1 (31 мкМ) в отсутствие и в присутствии аденина (500 мкМ). Меченый 30SΔS1 (30 нМ) инкубировали с серией разведений 1:1 rS1 (3 мкМ). Комплексы инкубировали в течение 30 мин при 25°С в ЯМР-буфере (25 мМ фосфата калия, рН 7,2, 150 мМ KCl, 5 мМ MgCl 2 , 5 мМ ДТТ) с добавлением 0.4 мг/мл BSA (New England Biolabs), 0,05% Tween20 и РНКазин (Promega, Германия). Реакции переносили в гидрофобные капилляры и измеряли с помощью прибора для микротермофореза (МСТ) (NanoTemper Monolith NT.115, Германия). После первичного капиллярного сканирования проводили эксперименты по термофорезу при 25 °С с мощностью возбуждения и МСТ по 40% каждая. Для каждого образца было записано четыре скана. Анализ был выполнен с использованием MO.Affinity Analysis и стратегии оценки T-Jump.

In vivo анализ экспрессии генов, регулируемых аденин-чувствительным рибопереключателем

BL21(DE3) Клетки E. coli трансформировали плазмидой pUC19, содержащей регуляторные элементы T7 и сдвинутый ген зеленого флуоресцентного белка (sGFP) под трансляционным контролем аденина -чувствительный рибопереключатель ASW14–122. Для предварительного культивирования отбирали одну колонию и добавляли ее в 5 мл минимальной среды М9, содержащей 100 мг/мл ампициллина и IPTG, и инкубировали в термошейкере (37°С, 120 об/мин) в течение ночи.Предварительную культуру использовали для инокуляции 50 мл основных культур М9/ампициллин с различными концентрациями аденина и IPTG в биологических трех повторностях с начальной ОП 600 , равной 0,1, которые выращивали в термошейкере (37°С, 120 об/мин). Производство sGFP контролировали по эмиссии флуоресценции ( λ ex = 484 нм и λ em = 510 нм) с помощью устройства для считывания микропланшетов Tecan Infinite M200 pro (Tecan, Маннедорф, Швейцария). Для оценки погрешности трижды измеряли три независимых биологических образца.Результаты были нормализованы к условиям роста 0 мМ аденина и 0 мМ IPTG. В качестве дополнительного контроля измеряли нетрансформированные клетки BL21(DE3) E. coli .

Совместный анализ транскрипции-трансляции in vitro

Совместный анализ транскрипции-трансляции in vitro и приготовление клеточного экстракта проводили, как описано ранее 42 , для мониторинга уровней экспрессии белка смещенного зеленого флуоресцентного белка (sGFP). Реакции бесклеточной экспрессии белка проводили с экстрактами клеток S100 собственного производства из штамма E.coli штамм BL21 Star TM (DE3) и рибосомы, обедненные rS1 (конечная концентрация 0,46 мкМ). Препарат экстракта S100 был адаптирован из протокола экстракта S30 Schwarz et al. 43 Наш препарат отличается на этапе диализа. Здесь экстракт S100 подвергали диализу при 4 °C против буфера для диализа (10 мМ Трис/ацетат (pH 8,2), 14 мМ Mg(OAc) 2 , 60 мМ KOAc, 0,5 мМ DTT) с использованием диализной мембраны (MWCO 12). -14 кДа, ZelluTrans, Carl Roth, Германия). Диализ проводили в течение 3 часов, буфер заменяли каждый час.После диализа экстракт S100 центрифугировали при 40000 об/мин и 4°С в течение 5 ч под вакуумом (Beckman Coulter Optima TM L-90 K). Белок синтезируется из плазмиды pUC19, содержащей регуляторные элементы Т7. Ген sGFP находится под трансляционным контролем чувствительного к аденину рибопереключателя ASW14–122, который содержит слабый сайт связывания рибосомы и стартовый кодон AUG. Реакции объемом 30 мкл проводили в трех повторностях в 384-луночных плоскодонных микропланшетах µClear® (Greiner Bio-One, Frickenhausen, Germany) при 25°C в течение 2 часов.Производство sGFP контролировали по флуоресценции sGFP ( λ ex = 470 нм и λ em = 515 нм) с помощью устройства для чтения микропланшетов Tecan Spark® (Tecan, Маннедорф, Швейцария). Для оценки погрешности один биологический образец измеряли в трех повторностях. В качестве положительного контроля использовали нативные 70S рибосомы.

Структурное моделирование комплексов мРНК-рибосома

Структура рибопереключателя была смоделирована в канал декодирования мРНК 30S рибосомы.

Для структурного моделирования была выбрана структура 30S рибосомного преинициаторного комплекса с PDB ID 5lmn. Белки IF1, IF3 и Thx были удалены из структуры.

Структура рибопереключателя, чувствительного к аденину, была построена следующим образом: в качестве отправной точки использовалась структура голоаптамера (C13–G83) с идентификатором PDB ID 1y26. Здесь из структуры были удалены нуклеотиды C13 и G83.

Для построения одноцепочечной области мРНК использовался онлайн-инструмент RNAthread (ROSIE) 44,45 .Здесь одноцепочечная мРНК из структуры 5lmn с 20 нуклеотидами использовалась в качестве входной структуры. Нуклеотиды заменяли шагами по 10–20 нуклеотидов на желаемую последовательность ASW. Затем полученная структура была перенумерована в соответствии с последовательностью ASW с помощью инструмента renumber_PDB.

Последовательности были выровнены в двух ячейках, каждая из которых содержала два перекрывающихся нуклеотида. Выравнивание выполнено в Pymol. Эта процедура обеспечила сохранение правильной геометрии позвоночника.Лишние нуклеотиды из выравнивания удалялись вручную в текстовом редакторе. мРНК в структуре 5lmn была заменена смоделированной структурой ASW, сохранив то же положение триплета GAG (G110-G112) из ​​последовательности Шайна-Далгарно, который спаривается с рРНК (C1536-C1538).

Сводка отчета

Дополнительную информацию о дизайне исследования можно найти в Сводке отчета об исследовании природы, связанной с этой статьей.

Брак? Нет, спасибо Перевод главы 1 на английском языке

Название: Kekkon Yosou yo 1
Английские идеи: «Брак? Нет, спасибо» или «Давайте избегать брака» или «Давай не поженимся»

Страница 01-

SFX (в центре справа) : «шлифовать молоть»

Звуковой эффект (в центре посередине): «Ак!»

Стр. 02-

Содержание

* Трава всегда зеленее
во дворе этого проклятого принца по соседству!

* Говорят, что любовь будет жить
навсегда…

* Иди погрейся в
круглосуточной ванне, почему бы и нет!

* Только свидания до продления аренды квартиры?!

Стр. 03-

Мужчина (вверху справа): «Завтра свадьба…»
«в 10:00, верно?»
(«Чертовски рано…»)

Женщина (вверху посередине): «Значит, нам нужно вставать около 7 утра?»
(вверху слева): «В воскресенье? Это отстой…»

Мужчина (в центре справа): «Зачем вообще все женятся?
Я не понимаю!»
Звуковой эффект (в центре посередине): «скраб-скраб-скраб»

Женщина (в центре слева): «Я знаю, верно?
Это пятая пара в этом году!»
(«Я сломался от всех свадебных подарков!»)

Мужчина (внизу справа): «Я никогда не думал о женитьбе.
(«Я в порядке один».)

Женщина (внизу справа): «Я тоже, я тоже!»

Мужчина (внизу посередине): «Знаешь, я просто хочу жить настоящим ?»

Женщина (внизу посередине): «Все так, как всегда, верно?»

Мужчина (внизу посередине): «Мы»
«такая хорошая пара!»
SFX (внизу посередине): » поцелуй»

Текстовое поле (внизу посередине): «Хотя
я не решил, что никогда не выйду замуж.»

SFX (внизу слева): «стук» сейчас.»)
«Не забудь этот массаж перед сном, да?»

Текстовое поле (внизу слева): «Но с этой девушкой…»

Мужчина (внизу слева): (Ах!)

Страница 04 —

Заголовок (вверху справа): «Трава всегда зеленее
Во дворе у этого проклятого принца по соседству!»

Страница 05-

Нет текста

Страница 06-

Священник (вверху справа): «Женитьба»
«не только для улучшения состояния и положения»,
(вверху слева): «ни для создание детей.
(в центре справа): «Но символ вечной доверительной связи
между двумя людьми, которые хотят разделить свою жизнь».
(внизу слева): «В болезни или в здравии-»

Мужчина (внизу справа) : («Зевок»)

Женщина (внизу слева): («Давай!»)

Страница 07-

Звуковой эффект (в центре справа): «молчать»

Мужчина (вверху посередине): («Ой!! «)

Женщина (в центре посередине): «Проснулась?»

Мужчина (в центре слева): («Но, но! Прошлой ночью ты заставил меня сделать тебе двухчасовой массаж! Конечно
Я устал!» )

Женщина (в центре слева): «Тише.»

Гости (внизу справа): «Поздравляем!»
(внизу посередине): «Поздравляем!»
(внизу слева): «С наилучшими пожеланиями!»

SFX (внизу слева): «О!»

Страница 08 —

Женщины (вверху посередине): «Какой красивый жених!»
(вверху слева): «Видимо, они сошлись на первом свидании!»
(в центре слева): «А он богатый банкир!» (» Только подумайте! Жена банкира!»)

Женщина (в центре посередине): («Вау!»)

Томоми (в центре справа): «О!»
(внизу справа): «Мицуба-сэмпай!»
«Иватоби -кун!»

Иватоби (внизу справа): («Сап!»)

Мицуба (в центре посередине): «П-поздравляю, Томоми…»
(внизу посередине): «Спасибо!»

Иватоби (в центре слева): «Только посмотрите на нашего позднего расцветающего Томоми!»
(«Это здорово!»)

Томоми (внизу слева): «В старшей школе мы все были в одном клубе!»

Страница 09 —

Томоми (вверху справа): «Оканоуэ Мицуба-сан, один год мой сен иор.
(вверху слева): «И Иватоби Коута-кун с моего курса».

Мицуба (вверху посередине): («А-ха-ха…»)

Иватоби (вверху слева): «Поздравляю и все такое…»

Муж (в центре справа): «Меня зовут Нагумо Кейити»
(внизу справа): «Приятно познакомиться»

Томоми (в центре посередине): «Увидимся на стойке регистрации!» («В отеле T! «)
SFX (внизу посередине): «смотреть»

Иватоби (внизу посередине): «Мицуба?»

SFX (в центре посередине): «слабо»

Иватоби (в центре слева): «Эй!»
«Ты ладно?»
(внизу слева): («А?»)

Звуковой эффект (внизу слева): «Удар!»

Иватоби (внизу слева): («А?») («А?») («А? ?»)

Стр. 10-

Мицуба (вверху справа): «Всё!»
(вверху посередине): «Наконец-то я нашла идеального мужчину!
Извините, похоже пора расставаться!»

Иватоби (вверху слева): «Вы… не можете иметь в виду, что…»

Звуковой эффект (вверху слева): «колебание»

Мицуба (вверху слева): » Нагумо-сааан…»

Иватоби (в центре справа): «Эй, привет…»
(в центре посередине): «Что ты говоришь…?»

Текст (в центре посередине): («Конечно, она не думает .»)

SFX (в центре слева): «vroom»
«clank clank»

Mitsuba (в центре слева): «My perfect priiiince…»

SFX (внизу справа): «yank»

Iwatobi (внизу справа) : «Открой глаза!!»

Звуковой эффект (внизу посередине): «УДАР»

Мицуба (внизу слева): («А?»)

Иватоби (внизу слева): («Хафф, хафф»)

Страница 11-

Мицуба (вверху справа): «Коута…
Я…»
«только что сказал что-нибудь странное?»
(в центре посередине): «Что-то возмутительное?»

Иватоби (в центре посередине): «Ага.
(вверху слева): «Вещи, которые заставили бы ангелов плакать, если бы они услышали это снова».

Мицуба (вверху слева): «Эк!» «Но ведь меня никто не слышал, верно?
Верно?»

Иватоби (в центре слева): «Я слышал тебя.»
«Ага.»

Мицуба (в центре слева): «Да, но ты это ты!»
(внизу справа): «… Глупый меня.
Потерять его при виде мужчины лучше меня.»
(«О боже…»)

Иватоби (внизу слева): («Не волнуйся.»)
«Да, ну, я такой же.»
(«Водитель, в отель «Т»)

Мицуба (внизу посередине): «Томоми…
такая милая девушка. И я желаю ей счастья.»
SFX: «блеск»

Иватоби (внизу посередине): «Хорошо, хорошо!
Продолжай в том же духе!»

Текст (внизу посередине): «Не то чтобы я считаю»
«женитьба = счастье, в конце концов.» Страница 12-

Текстовое поле (вверху справа): «Почему в мире существует только 2 типа женщин?»
(вверху слева): «Те, кто может, и те, кто не могут сделать тебя счастливым?»

Звуковой эффект (вверху справа): «Великолепно!»
(вверху посередине): «Поздравляю!»

Иватоби (в центре справа): «Хмф!»
«Есть только один тип парней — те, кто цепляется.»

Мицуба (в центре посередине): «Томоми»
«хотя всегда был замкнутым и застенчивым.»
(внизу справа): «И все же ему всегда везло.»

Иватоби (внизу справа): «Ага, да…»

Мицуба (внизу справа): «Томоми! Они едут быстро!»

Томоми (внизу справа): «Все в порядке. Я возьму остатки.»

Текстовое поле (внизу посередине): «Но эти остатки…»

Томоми (внизу посередине): «О!»
«Внутри было два кусочка осьминога!» ): «Что—?»

Текст (внизу посередине): («Не стоит удивления.»)

Иватоби (внизу посередине): «В отличие от тех, что хватали, что могли, и это было отвратительно.»

Мицуба (внизу слева): «Ты имеешь в виду как я?» , ну, я взял три штуки, и ни в одной из них вообще не было осьминога…»
SFX (внизу слева): «шмыгнуть»

Мицуба (внизу слева): «Давай уже прекратим эти старые клубные истории о такояки!»

Страница 13-

Мадока (вверху справа): «Какие воспоминания!
Вкус этого такояки.
(вверху посередине): «Бонжур!»
«Я слышал, вы еще не поженились?
Поддайтесь неизбежному уже!»

Звуковой эффект (вверху справа): «Вааа! Вах!»

Текст (вверху посередине): («Бывшая красавица девичьего футбольного клуба»)

Иватоби (вверху слева): «Мадока!»
«Как дела?»

Мицуба (вверху слева): » Вау…»
(«Ах!»)
(в центре справа): «Вау, Мадока. Ты потрясающая.»
(«А, я слышала, ты уже прошла через это…»)
(в центре посередине): «Заботиться о ребенке как мать-одиночка…»

Мадока (в центре слева): » О, не волнуйся.
(внизу справа): «Я снова вышла замуж».

Муж (внизу справа): «Приятно познакомиться».

Мадока (внизу справа): «Мой новый муж».

Мицуба (внизу справа): («О!»)

Мадока (внизу посередине): «А у меня еще один ребенок в духовке.»

Мицуба (внизу посередине): («Вау!»)
(«Я думал, ты только что начал толстая!»)
(внизу слева): («Приносим извинения»)
(«за то, что не заметили, несмотря на наши одинаковые 26 лет»)

Иватоби (внизу слева): «Ну, по крайней мере, теперь она обрела счастье .»

Мицуба (внизу слева): «Угадай.»

Страница 14-

«Девушка, похожая на Томоми»
«которая провела 25 лет, не будучи ничем особенным»
(вверху посередине): «даже»
«умудрилась найди хорошего парня.»

SFX (вверху справа): «повернуться повернуться»
«смотреть»

Мицуба (вверху посередине): «Думаю, невеста хочет, чтобы ее лучшие гости были рядом только для того, чтобы она хорошо выглядела , да?»

Иватоби (вверху слева): «поворот, поворот»

Мицуба (в центре посередине): («Ты тоже это чувствуешь?»)
(«LOL!»)
(внизу справа): «Тогда ,
думаю, стоит попробовать?»

Иватоби (внизу справа): «Хорошая идея!
Ради нашего будущего!»

Мицуба (внизу посередине): «Эй, если это делает нас счастливыми!
Не то чтобы я думал, что брак равен счастью или чему-то еще.»

Иватоби (внизу слева): «Ты тоже?»
«Да, не так много.» Хм?»

MC (вверху слева): «А теперь!»
«Давайте пусть старые школьные друзья невесты споют нам песню!»
Звуковой эффект (вверху слева): «Вит! Ух!»
(в центре справа): «В школьной форме!»
«Баллада об эпохе Сёва!»

Текстовое поле (внизу справа): «К черту.
Свадьбы»
(внизу слева): «Большая боль.

Звуковой эффект (внизу): «хлоп-хлоп-хлоп-хлоп»

Мицуба (внизу посередине): («Знаешь…»)
(«Моя форма не была школьной одеждой…»)

Иватоби (внизу посередине) ): («Я тоже. Совсем не такой стиль униформы».)

Страница 16-

Текстовое поле (вверху справа): «Что такого интересного в счастье других людей?»
(вверху посередине): «The свадебное кимоно и дорогие головные уборы.
Самый громоздкий из свадебных нарядов.»
(вверху слева): «Речи, курение, разрезание торта…
Самый дорогой свадебный наряд.
(в центре слева): «Мы не хотим такого счастья».

Текст песни (вверху справа): «Встреча с бывшим~
В ту ночь, как раньше~
Это все потому, что я слишком много выпил~
Любовное письмо от~
Гинза только для нас~
Можем ли мы забыть?~
(вверху слева): «Давай поженимся~
Хотя переезд стоит дорого~
Те, у кого нет жен, пойдем со мной~
I может и не прийти~
Так что не беспокойся~»
«А теперь готовим!»

Нагумо (в центре справа): «Они веселая пара.»

Томоми (в центре посередине): «Правильно?»
(в центре слева): «Все всегда хотят их на своей церемонии.»
(внизу справа): «Знаете, они уже живут вместе.»

Нагумо (внизу справа): «О?»

Томоми (справа внизу): «Но они не собираются жениться. Это расстраивает.»
(внизу посередине): «Если бы только эти двое сошлись, понимаете?»
(внизу слева): «Вот почему я-»

SFX (внизу посередине): «бип-бип»

Текст песни (внизу слева): «Разыскивается~
Кармен~
Пеппо~
Сексуальная~
Такая сексуальная леди~
Человек-невидимка~
Монстр~»
«Кто-нибудь, остановите их!»

Стр. справа): «Я хочу, чтобы они знали, какой прекрасной может быть супружеская жизнь!»
(вверху посередине): «Мы можем показать их двоих!»
Звуковой эффект: «сжать»
(вверху слева): «Ты поможешь меня, правда, дорогая?»

Нагумо (вверху слева): «О-
Конечно…»

Мицуба (в центре справа): («Что за—«)
«Беспокойство!»
(внизу справа): «Как мы всегда вынуждены выступать на каждой свадьбе…?»
Звуковой эффект: «шатание»
(«Заставляет нас начинать афтепати, и все еще в этой форме!»)

Иватоби (внизу справа): « Вот почему нас так часто приглашают…»

Митсуб a (внизу справа): «Это так…?»

Иватоби (внизу посередине): «Не совсем нашел счастье, да?»
(«Вздох…»)

Мицуба (внизу посередине): «Нет… »

Текстовое поле (внизу слева): «Мое имя «Мицуба» означает трехлистный клевер.
Точно так же и мне всегда не хватает одного листа счастья…»

Текст (внизу слева): («Можно ли взять из твоего имени символ удачи?»)
(«Черт возьми! один из тех!»)

КОНЕЦ

Как Фрэнсис Форд Коппола спас американское граффити от посредственности телефильма

Честно говоря, приведенное выше резюме звучит так, будто «Американские граффити» больше основаны на сюжете и имеют более высокие ставки, чем на самом деле. Фильм, по большому счету, представляет собой череду переплетений виньеток, в которых негодяи-подростки из Модесто попадают в беду, путешествуя по своей родной территории ночью.Их выходки редко переходят черту и становятся по-настоящему опасными, по крайней мере, до почти фатальной гонки на перетаскивание, которая становится кульминацией фильма. Эта сцена, где хвастливый персонаж Харрисона Форда Боб Фальфа берет на себя чемпиона Модесто по дрэг-рейсингу Джона Милнера (которого играет Пол Ле Мэт), также была ранней демонстрацией того, что Лукас мог сделать как режиссер боевиков, за четыре года до того, как он снял «Звездные войны». » Но для руководителей Universal Pictures, которая финансировала «Американские граффити», этот новаторский на тот момент тип кинематографического повествования был скорее запутанным и тревожным, чем воодушевляющим.

Да, несмотря на то, что «Американское граффити» выглядит и ощущается как независимый фильм, на самом деле это был студийный фильм, который воспринимался как «инди» только из-за небольшого бюджета.

Leave a comment